Review



paper addgene 236332 lenticrispr vpr  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 93
      Buy from Supplier

    Structured Review

    Addgene inc paper addgene 236332 lenticrispr vpr
    Paper Addgene 236332 Lenticrispr Vpr, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/paper+addgene+236332+lenticrispr+vpr/pDONR223-LYK5+(Plasmid+%2323633)/pm40273915-766-198-199
    Average 93 stars, based on 1 article reviews
    paper addgene 236332 lenticrispr vpr - by Bioz Stars, 2026-10
    93/100 stars

    Images

    Related Articles

    Virus:

    Article Title: Pooled tagging and hydrophobic targeting of endogenous proteins for unbiased mapping of unfolded protein responses.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies HaloTag, mouse mAB Promega G9211; RRID: AB_2688011 HaloTag, rabbit pAB Promega G9281; RRID: AB_713650 GFP, mouse mAB Santa Cruz sc-9996; RRID: AB_627695 LC3B, rabbit pAB Novus Biologicals NB100-2220; RRID: AB_10003146 GAPDH, rabbit mAB Cell Signaling 2118; RRID: AB_561053 GAPDH, mouse mAB Abcam ab8245; RRID: AB_2107448 Vimentin, rabbit pAB GeneTex GTX100619; RRID: AB_1952557 Bacterial and virus strains Endura Electrocompetent Cells Lucigen 60242-2 One Shot Stbl3 Chemically Competent E. coli Invitrogen C737303 ZYCY10P3S2T E. coli Minicircle producer strain System Biosciences MN900A-1 Experimental models: Cell lines HAP1 Horizon Discovery C859 HEK 293 ATCC CRL-1573 HeLa ATCC CCL-2 Chemicals, peptides, and recombinant proteins HyT36 Tae et al.24 N/A GTPP MedChem Express HY-102007A CDDO Cayman Chem 81035 Thapsigargin Fisher Scientific AC328570010 Tunicamycin MilliporeSigma T7765 Tanespimycin (17-AAG) MedChemExpress HY-10211 Bafilomycin A1 Thermo Scientific J67193.XF HaloTag TMR Promega G8251 HaloTag JFX549 Promega GA1110 Recombinant DNA pMC_mClover3_BSDminus_F0 Serebrenik et al.14 Addgene 184165 pMC_mClover3_BSDminus_F1 Serebrenik et al.14 Addgene 184166 pMC_mClover3_BSDminus_F2 Serebrenik et al.14 Addgene 184167 pMC_HT2_BSDminus_F0 This paper Addgene 236329 pMC_HT2_BSDminus_F1 This paper Addgene 236330 pMC_HT2_BSDminus_F2 This paper Addgene 236331 sgDonor_lentiGuide Serebrenik et al.14 Addgene 184168 lentiCRISPR v2 Sanjana et al.71 Addgene 52961 lentiCas9-Blast Sanjana et al.71 Addgene 52962 lentiCRISPR_dMSK1 This paper Addgene 236332 lentiCRISPR_VPR This paper N/A CROPseq-Guide-Puro Datlinger et al.72 Addgene 86708 pMDLg Dull et al.73 Addgene 12251 pMD2g Dull et al.73 Addgene 12259 pRSV-REV Dull et al.73 Addgene 12253 XBP1-nLucP Raina et al.27 N/A (Continued on next page) Molecular Cell 85, 1868–1886.e1–e12, May 1, 2025 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER SHISA3-mClover3 This paper N/A mClover3-SHISA3 This paper N/A CTXN1-mClover3 This paper N/A mClover3-CTXN1 This paper N/A HSPD1-i7-HT2 This paper Addgene 236333 CALR-i2-HT2 This paper Addgene 236334 EPHA2-i16-HT2 This paper Addgene 236335 Critical Commercial Assays Revertaid H minus RT Thermo Fisher EP0442 Ribolock RNase inhibitor Thermo Fisher EO0382 RNase H Qiagen Y9220L TaqIT DNA polymerase Qiagen P7620L Ampligase Lucigen A3210K, A1905B Phi29 DNA polymerase Thermo Fisher EP0094 MiSeq Reagent Nano Kit v2 (500-cycles) Illumina MS-103-1003 Next GEM Single Cell 3’ HT Kit Chromium CG000416, Rev C CellTiter-Glo Promega G7570 Nano-Glo Luciferase Assay Promega N1110 ONE-Step Luciferase Assay BPS Bioscience 60690 HSE Luciferase Reporter Lentivirus BPS Bioscience 78669 BD Cytofix/Cytoperm Fixation/Permeabilization Kit BD Biosciences 554714 Oligonucleotides oRT_CROPseq: G+AC+TA+GC+CT+TA+ TT+TTAACTTGCTAT Feldman et al.30 N/A oPD_CROPseq: /5Phos/gttttagagctagaaa tagcaagCTCCTGTTCGACACCTACCCAC CTCATCCCACTCTTCAaaaggacgaaacaccg Feldman et al.30 N/A oSBS_CROPseq: CACCTCATCCCACTCTTCAaaaggacgaaacaccg Feldman et al.30 N/A AAVS1_1_sgRNA: GGGGCCACTAGGGACAGGAT Mali et al.74 N/A AAVS1_2_sgRNA: GTCCCCTCCACCCCACAGTG Mali et al.74 N/A AAVS1_3_sgRNA: TGTCCCTAGTGGCCCCACTG Richardson et al.75 N/A AAVS1_4_sgRNA: ATCCTGTCCCTAGTGGCCC Mali et al.74 N/A Table S1: Primary pooled tagging library This paper N/A Table S3: Compact compartment wide pooled tagging library This paper N/A Table S5: Unannotated genes pooled tagging library This paper N/A Table S6: sgRNA sequences used to tag unannotated proteins in arrayed format This paper N/A Software and Algorithms Nikon Elements Nikon v5.21.03 Snakemake Köster and Rahmann76 https://snakemake.readthedocs.io/en/stable/ Genotype assignment functions Feldman et al.39 https://github.com/feldman4/OpticalPooledScreens Deposited data Single-cell RNA sequencing reads This paper GEO: GSE290832 SPOTLITES GitHub repository This paper GitHub: https://github.com/shalemlab/SPOTLITES, Zenodo: https://doi.org/10.5281/zenodo.14991116 Randomly sampled cell images for all recovered tagging sgRNAs, genes A-J This paper Figshare: https://doi.org/10.6084/m9.figshare.

    Recombinant:

    Article Title: Pooled tagging and hydrophobic targeting of endogenous proteins for unbiased mapping of unfolded protein responses.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies HaloTag, mouse mAB Promega G9211; RRID: AB_2688011 HaloTag, rabbit pAB Promega G9281; RRID: AB_713650 GFP, mouse mAB Santa Cruz sc-9996; RRID: AB_627695 LC3B, rabbit pAB Novus Biologicals NB100-2220; RRID: AB_10003146 GAPDH, rabbit mAB Cell Signaling 2118; RRID: AB_561053 GAPDH, mouse mAB Abcam ab8245; RRID: AB_2107448 Vimentin, rabbit pAB GeneTex GTX100619; RRID: AB_1952557 Bacterial and virus strains Endura Electrocompetent Cells Lucigen 60242-2 One Shot Stbl3 Chemically Competent E. coli Invitrogen C737303 ZYCY10P3S2T E. coli Minicircle producer strain System Biosciences MN900A-1 Experimental models: Cell lines HAP1 Horizon Discovery C859 HEK 293 ATCC CRL-1573 HeLa ATCC CCL-2 Chemicals, peptides, and recombinant proteins HyT36 Tae et al.24 N/A GTPP MedChem Express HY-102007A CDDO Cayman Chem 81035 Thapsigargin Fisher Scientific AC328570010 Tunicamycin MilliporeSigma T7765 Tanespimycin (17-AAG) MedChemExpress HY-10211 Bafilomycin A1 Thermo Scientific J67193.XF HaloTag TMR Promega G8251 HaloTag JFX549 Promega GA1110 Recombinant DNA pMC_mClover3_BSDminus_F0 Serebrenik et al.14 Addgene 184165 pMC_mClover3_BSDminus_F1 Serebrenik et al.14 Addgene 184166 pMC_mClover3_BSDminus_F2 Serebrenik et al.14 Addgene 184167 pMC_HT2_BSDminus_F0 This paper Addgene 236329 pMC_HT2_BSDminus_F1 This paper Addgene 236330 pMC_HT2_BSDminus_F2 This paper Addgene 236331 sgDonor_lentiGuide Serebrenik et al.14 Addgene 184168 lentiCRISPR v2 Sanjana et al.71 Addgene 52961 lentiCas9-Blast Sanjana et al.71 Addgene 52962 lentiCRISPR_dMSK1 This paper Addgene 236332 lentiCRISPR_VPR This paper N/A CROPseq-Guide-Puro Datlinger et al.72 Addgene 86708 pMDLg Dull et al.73 Addgene 12251 pMD2g Dull et al.73 Addgene 12259 pRSV-REV Dull et al.73 Addgene 12253 XBP1-nLucP Raina et al.27 N/A (Continued on next page) Molecular Cell 85, 1868–1886.e1–e12, May 1, 2025 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER SHISA3-mClover3 This paper N/A mClover3-SHISA3 This paper N/A CTXN1-mClover3 This paper N/A mClover3-CTXN1 This paper N/A HSPD1-i7-HT2 This paper Addgene 236333 CALR-i2-HT2 This paper Addgene 236334 EPHA2-i16-HT2 This paper Addgene 236335 Critical Commercial Assays Revertaid H minus RT Thermo Fisher EP0442 Ribolock RNase inhibitor Thermo Fisher EO0382 RNase H Qiagen Y9220L TaqIT DNA polymerase Qiagen P7620L Ampligase Lucigen A3210K, A1905B Phi29 DNA polymerase Thermo Fisher EP0094 MiSeq Reagent Nano Kit v2 (500-cycles) Illumina MS-103-1003 Next GEM Single Cell 3’ HT Kit Chromium CG000416, Rev C CellTiter-Glo Promega G7570 Nano-Glo Luciferase Assay Promega N1110 ONE-Step Luciferase Assay BPS Bioscience 60690 HSE Luciferase Reporter Lentivirus BPS Bioscience 78669 BD Cytofix/Cytoperm Fixation/Permeabilization Kit BD Biosciences 554714 Oligonucleotides oRT_CROPseq: G+AC+TA+GC+CT+TA+ TT+TTAACTTGCTAT Feldman et al.30 N/A oPD_CROPseq: /5Phos/gttttagagctagaaa tagcaagCTCCTGTTCGACACCTACCCAC CTCATCCCACTCTTCAaaaggacgaaacaccg Feldman et al.30 N/A oSBS_CROPseq: CACCTCATCCCACTCTTCAaaaggacgaaacaccg Feldman et al.30 N/A AAVS1_1_sgRNA: GGGGCCACTAGGGACAGGAT Mali et al.74 N/A AAVS1_2_sgRNA: GTCCCCTCCACCCCACAGTG Mali et al.74 N/A AAVS1_3_sgRNA: TGTCCCTAGTGGCCCCACTG Richardson et al.75 N/A AAVS1_4_sgRNA: ATCCTGTCCCTAGTGGCCC Mali et al.74 N/A Table S1: Primary pooled tagging library This paper N/A Table S3: Compact compartment wide pooled tagging library This paper N/A Table S5: Unannotated genes pooled tagging library This paper N/A Table S6: sgRNA sequences used to tag unannotated proteins in arrayed format This paper N/A Software and Algorithms Nikon Elements Nikon v5.21.03 Snakemake Köster and Rahmann76 https://snakemake.readthedocs.io/en/stable/ Genotype assignment functions Feldman et al.39 https://github.com/feldman4/OpticalPooledScreens Deposited data Single-cell RNA sequencing reads This paper GEO: GSE290832 SPOTLITES GitHub repository This paper GitHub: https://github.com/shalemlab/SPOTLITES, Zenodo: https://doi.org/10.5281/zenodo.14991116 Randomly sampled cell images for all recovered tagging sgRNAs, genes A-J This paper Figshare: https://doi.org/10.6084/m9.figshare.



    Similar Products

    paper addgene 236332 lenticrispr vpr  (Addgene inc)
    93
    Addgene inc paper addgene 236332 lenticrispr vpr
    Paper Addgene 236332 Lenticrispr Vpr, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/paper+addgene+236332+lenticrispr+vpr/pDONR223-LYK5+(Plasmid+%2323633)/pm40273915-766-198-199
    Average 93 stars, based on 1 article reviews
    paper addgene 236332 lenticrispr vpr - by Bioz Stars, 2026-10
    93/100 stars
    		  Buy from Supplier

    Image Search Results